Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST62406
Clone ID OST62406
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST62406
Sequence
ACTGAGATCAATTAAAAGAAGAATGANCTGTACNTCCCTGAAGATAAAACTGGACAGCTTTTTCATTTAGTATATGTATA
TTTTTAATTATAAAAGTTCAGGTGGAGTCTTCAGTTTATCAGTACTGAGCAGCAGATCACCATTTTCAGGGACGATACCT
GCCTCTTCTTTTTTGGTGTTCTTGGCAAAAATTAAACCCATTGCGTCATTGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16469

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30995623..30995829 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027660 (Skil) NM_011386 SKI-like Gene [Source:MGI (curated);Acc:Skil-001]

 
Come back to gene ENSMUSG00000027660


For any suggestions or comments, please send an email to unitrap@crg.es