Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST61530
Clone ID OST61530
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST61530
Sequence
CATGTGAACTTCACTCANGANGAGTGGGCTTTGCTGGATGCTTCTCAGAAGAGTCTCTACAAAGGTGTGATGGTAGAGAC
CTATAGGAATCTCACAGCTATAGGTTACAGTTGGGAAGAACATACAATTGAAGACCATTTCCAAACTTCTAGAAGTCATG
GAAGGTAATTTTCCTCTGCAAGCTGATGAGAAAATGCCTATGAAGAAAGTTTAACGTGTGCTACAAGTAGTAAAGAAAAC
CAATAGGGTACAATAAGCACTGCTTTCAGTTATGGATGTTTATTGAATTTCATAAAATCATATATGTCTATGGCCAAAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI25083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175596741..175694821 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078891 (BX890623.7-201) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:B1AYE1]

 
Come back to gene ENSMUSG00000078891


For any suggestions or comments, please send an email to unitrap@crg.es