Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60967
Clone ID OST60967
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60967
Sequence
TTGAAACACTGAGCATTGACTGAAGGCTATGTGGGGACCCTGCAGGAGAGCAGACAGGACAAGCTCAGTGCAGATCCGCA
GACGAAAGGCATCCGGAGACCCATACTGGGCGTATTCTGGTTTTCGAGGTGTGCTTGACACAGAGGAATAAAGTGTTGAA
ATCAAAGCTGAGCCTGAGACGAAGTACTGCATGAACACGATTCTCCTACCAGCCGTGAGATGCCAGGACTTGGAAGG
Sequence Type mRNA
Unitrap ID UNI16496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12553627..12707041 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es