Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60839
Clone ID OST60839
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60839
Sequence
ACTGACTGCGAGTCCCCCAGTTCCCCTGGAGATCTAGCTGGGAGCCCAGGCTGTGACAAGACACGCGGCTGTGCAAAGGC
GGTTAGACATTATGGAGGAGACGGTGGAGAAGACAGTGGAGCACCTGGAGGCGGAAGTGACAGGTCTGCTGGGCCTGCTG
GAGGAACTGGCTTCAAACCTTCCCACAGGGCCCTTCAGCCCCAAACCTGACTTGCTTGGAGATGATGGTTTCTGACTTCC
AGGGATGGTGGAGCCTGCCAGCTGAAGTCATCCCTCANAGAACCAAGCCAGGTCTTCCTGCCTTCCTGCCCCACCTTTGT
GTGAAATAAAAGCTCCGATTTGGACCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26707889..26710337 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072681 (Plac9) NM_207229 placenta specific 9 Gene [Source:MGI Symbol;Acc:MGI:2663998]

 
Come back to gene ENSMUSG00000072681


For any suggestions or comments, please send an email to unitrap@crg.es