Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60703
Clone ID OST60703
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60703
Sequence
CCGATGCCAGGATGGCAAGTNCNTCTCCCCGCAGTTTGTGTGTGATGGANACCGAGATTGCCTAGATGGCTCTGATGAGG
CCCACTGCCAGGCCACCACTTGTGGCCCCGCCCACTTTCGCTGCAA
Sequence Type mRNA
Unitrap ID UNI9146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21537963..21538088 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032193 (Ldlr) NM_010700 low density lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:96765]

 
Come back to gene ENSMUSG00000032193


For any suggestions or comments, please send an email to unitrap@crg.es