Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60654
Clone ID OST60654
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60654
Sequence
GACTGAGTCAAGGTGAAGAGAATGGGATTGACTGCAGCCAAGGAGACAAGCCTGCGGAGCGGGGCAAGCGGGCCCGAGGC
AGAGGATTTGGACGTGGCAGGGGCAGAGGGACAGGAAGGTTCTCCGCTCAAAGCATGGGGACATTCAATCCTGCAGACTA
TTCAGAGTCCATGTCTACAGATGGCTGTGGGACAAAGTTGGCAGTTTGGGAAGCTGCTCANAATGGTACAGATGAGGGAC
CGGGATTGTGAGTGTGTACACACAAGCTGTGGAGGGCAGAANACTTTCCGCTAGTGGATTACAAGAGTGTACTCAGGATC
TCCGGCCCTAATGGTTTGATCACCAATCCAGNGGAANCAAACTTTTATTCCTTAAAACCAATTACNTGAAATAAAAATTA
TCATAAGCATTAACCT
Sequence Type mRNA
Unitrap ID UNI27397

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41168818..41174311 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es