Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60634
Clone ID OST60634
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60634
Sequence
TCCAGGAGTGTGGTCCAGCTGGCAAGCACTGCAGCTCTAGATATTANAGATGCGGTTGTCTCACGCTCTAGTCTTCTACA
CAACTTAACTCTGTGTGGCATTGTCCTAGCTGGAAAGCCTTTTTCTTTTGTTCTCTGCCCTAGGCAGGGGTACCTCTGGA
GCCAGAGGTTCATAAGGTTCTTCTGGAAAGGATCTAGATGAACTGAGGTTATTAGCATGGGCTGGANNCCTGGGTTTTTT
AAATCTGCCTCTGTTTTGAAAAGGCTTGGTTCAATGGGGCA
Sequence Type mRNA
Unitrap ID UNI22010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65206530..65206807 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041837 (Pdcd7) NM_016688 programmed cell death 7 Gene [Source:MGI Symbol;Acc:MGI:1859170]

 
Come back to gene ENSMUSG00000041837


For any suggestions or comments, please send an email to unitrap@crg.es