Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60572
Clone ID OST60572
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60572
Sequence
GAACTGAGCAATGGCAGTTTTGATCGTAACAGAGAACTACCTGGAGTTTGGCCTTGAAACAGGGTTTACAAATTTTTCAG
ACAGTGCAATGCAGTTTCTTGAAAAGCAGGGTTTAGAATCTCATNTNNNNATNTAACCCTNNAANCNNAGCNTACNNANG
AGNGGGTGCTGACCTTAAACNCNCCTTGAGANNCCTTNACTGGAATACGGCTGGCTCAAATGCATCTGGATGCCCTGAAT
ATGGCAACAGAAAAAATTACACAATNGTNAATAATNTGCAACNTCCTGNATCCANTTNNTTTAACCACCAAATNCTATTT
TGATTCTAAGGAGAAAACATTAAACCTCTGCTCATGGCTCTGAAGCAG
Sequence Type mRNA
Unitrap ID UNI27403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 84422412..84424308 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035762 (Tmem161b) NM_175187 transmembrane protein 161B Gene [Source:MGI Symbol;Acc:MGI:1919995]

 
Come back to gene ENSMUSG00000035762


For any suggestions or comments, please send an email to unitrap@crg.es