Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60552
Clone ID OST60552
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60552
Sequence
GAACTGAGGGATATCCCTGTGGATTTTAAGTACATANGCAGAGCCCAGCATGCACTCAATGCCCGCAGTGACTTTGTCTC
CAAATGGGAAATGGCTAGCATGCCAGTCAATGGACAACCAAATCTTAATTTTTGGAGCACAGAACAGATTCAGATTGAAT
AAGAAGAAAATATTTAAGGGCCACATGGTAGCAGGCTACGCTTGTCAGGTAGACTTCTCACCAGACATCGTGAGATGCCA
GGACTTGGAAGGTG
Sequence Type mRNA
Unitrap ID UNI12201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40553985..40556172 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038446 (Cdc40) NP_082155 cell division cycle 40 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918963]

 
Come back to gene ENSMUSG00000038446


For any suggestions or comments, please send an email to unitrap@crg.es