Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60521
Clone ID OST60521
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60521
Sequence
TCAGAGAGGACAGATGCTACGGTGAACCCCCGCTCATTCTTTCTAAGGAATCCCAGTGAAAATACATTTGAACTGGTCCC
CCTGGGGGATGAGGAGGAGGAGGAGAAAAATGAAAGCGTCCTGCTGGAGGGTAGGGCAGTCTACTTAAATATAAGCCTTC
CTCCTCACACGCCGCCTCCTCCCTTNATCTCCGAGGACGCCTNCGGATATCTGACCAGCCCCTGGCTGACGCTCTTNATG
CCCTCCGTGTACACGATTGTGTTCATTGTCAGCCTTCCTCTGAACGTCCTGGCCATNGCAAGTGTTCGTCTTGAGGATGA
AAGTCAAGA
Sequence Type mRNA
Unitrap ID UNI26275

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96374563..96374890 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048376 (F2r) NM_010169 coagulation factor II (thrombin) receptor Gene [Source:MGI Symbol;Acc:MGI:101802]

 
Come back to gene ENSMUSG00000048376


For any suggestions or comments, please send an email to unitrap@crg.es