Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST60364
Clone ID OST60364
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST60364
Sequence
AACTGAGCTTCCCAGCGCAACATCAGCCTAAAGAAGCAAAGGGGTCGGAGCATCCTTAGCTCTTTCTTCTGCTGCTTCCG
AGACTACAATGTGGAAGCCCCTCCGGCCAACAGCCCCAGTGTGCTTCCGCCACTGGTGGAGGAGAACGGTGGGCTTCAGA
AGGGTGACCAGAGGCAGGTCATTCCCGTACCAAGCCCACCANNTAAANACCTCCTTNCANAGGNGACNGGNCTNCACTAT
GGAAAGAAANGTGNGGTCATTGATNTAGACGAAACCNTGGGGCACAGTTCGNTNAANCCCATTAGTANTGCTGACTTCAT
TGTTNCTGANGAAAACNACGGAACCATNCACCAGGAGTNTGTGCTNNAGCGAACNNACGTGGACCAATTNCTTCAAAAGA
NTGGGCACTTGTTTGANTGGGGGCTCAATAATGCCA
Sequence Type mRNA
Unitrap ID UNI15649

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118920351..118939371 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047409 (Ctdspl) NM_133710 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like Gene [Source:MGI Symbol;Acc:MGI:1916524]

 
Come back to gene ENSMUSG00000047409


For any suggestions or comments, please send an email to unitrap@crg.es