Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST59892
Clone ID OST59892
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST59892
Sequence
GACTGAGAGTGAGCCAGAAGAAATGCCTCCAGAAGCAAAGATGAGGATGAAGAACATTGGAAGGTGCCGTGCTTTCATAA
TTATCATAGAGCTGTAGGAGAAGCGAGGACAAGAATACAGTACACGTTACCACAAAGAATTAACATCTAAATCGATCTAC
AATCTCTAGGTCAATTAAATGCAGTCCCAGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56018456..56018642 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071533 (Pcnp) NM_001024622 PEST proteolytic signal containing nuclear protein Gene [Source:MGI (curated);Acc:Pcnp-008]

 
Come back to gene ENSMUSG00000071533


For any suggestions or comments, please send an email to unitrap@crg.es