Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0236
Clone ID BC0236
Vector pGT2lxr
Project sanger

Sequence tag BC0236
Sequence
CATTTCCTCTTATTAATTTTCTTGTCTTTTCACAGCCTGAGGTGGCTCCCCCAGCCCATGAGTCTCGGACAGAACTGGTT
CCTCCGCCTCCACCCTTACCCCCTTTGCCACCAGAAAGGACCAGTGGAATTGGGGACTCAAGGCCTCCATCCTTCCA
Sequence Type mRNA
Unitrap ID UNI929

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69818676..69818802 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020888 (Dvl2) NM_007888 dishevelled 2, dsh homolog (Drosophila) Gene [Source:MGI (curated);Acc:Dvl2-001]

 
Come back to gene ENSMUSG00000020888


For any suggestions or comments, please send an email to unitrap@crg.es