Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST59690
Clone ID OST59690
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST59690
Sequence
GACTGAGGGACTCTAATGAGCTGACCAGGACCATTTTACCAGTTGAAATGAGTTCTCAGAAATGAAGCATAGTGCTGTTA
GAGTCACCATGTAACGGACGGATGTGACTCCAAGCGCACCACTTCTTCATGCCAACCCTCTTTGACTGGGAAGGATCTTT
GTCTTTTCATCGTTGATCTGGATTGCTGGCGAGGAGGAGGAGTTCATGTAGTGTTTGAGTGAAGCTTGAGTCACCATGAG
TAGTAGTTTAGGAAAAGAAAAAGACTCTAATGAGAAAGACCCCAAAGTACCGTCTGCCAAGGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54061942..54062246 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024976 (Shoc2) NM_019658 soc-2 (suppressor of clear) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927197]

 
Come back to gene ENSMUSG00000024976


For any suggestions or comments, please send an email to unitrap@crg.es