Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST59589
Clone ID OST59589
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST59589
Sequence
GACTGAGGTCCCCCTGCTCAGCCAGATCTGCTCACCAGTGAATCAACTAAGAACCCTGGATGGTGAAGAGAGAGGAGACT
ATAGTAAAGAATCCAGGTATGTTAGAGGAACTGAACAAGGGGTGAGGTGGCCCTTAAGTGACAATAAAAAGAGAATGTGA
AAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27431

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23002150..23002305 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059142 (A630033E08Rik) NP_001103724 RIKEN cDNA A630033E08 gene Gene [Source:MGI Symbol;Acc:MGI:2445132]

 
Come back to gene ENSMUSG00000059142


For any suggestions or comments, please send an email to unitrap@crg.es