Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST59512
Clone ID OST59512
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST59512
Sequence
AGGAATGATCAATTGGAACCGGCTTTTCCCCCCTTTACGTCAGCGACGAAATATCAACTATCAAGATGGACCTCGGTCTG
AGCAGCGAGCATCTCCTCCCCTGGAAGTTTCTGAAGAGCAGGTTGCCCGCCTCATGGAGATGGGATTTTCCAGAGGGGAC
GCCTTGGAGGCCCTGAGGGCCTCAAACAATGACCTCAATGTGGCCACCAACTTCCTGCTGCAGCACTGACATCCAGCCAC
TGTATGACAGTGATGTGCCCGCCACCACATCAGCCTGAGGACCAAGCAGACCCCAGCACAGGTGTTCTCAAGAGGAGACG
GTGGTTCCCACCATACACTGTCCTTAAATCCAAGATGGTTGCCGCGTAGTATCAAATAAAGTTTTGCCTTTAATT
Sequence Type mRNA
Unitrap ID UNI4052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 122408015..122419441 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041765 (Ubac2) NM_026861 ubiquitin associated domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1916139]

 
Come back to gene ENSMUSG00000041765


For any suggestions or comments, please send an email to unitrap@crg.es