Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST59271
Clone ID OST59271
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST59271
Sequence
TTTCTACCACATGAGGTTCTTCTCCGAGCCGGNGTAAGTAGAGATGCCAGGACCAAAGTGGACCGGACACCACTGCACAT
GGCGGCTTCTGAGGGCCATGCCAACATAGTANAAGTTTTGCTTAAGCATGGTGCTGACGTCNATGCANAGGATATGTTAA
AGATGACAGCTCTGCATTGGGCAACAGAACATAATCATCAAGAGGTGGTGGAGCTTTTAATCAAATATGGNGCTGATGTA
CACACGCAGAGTAAATTTTGTAAAACTGCATTTGATATTTCAATAGACAATGGAAATGAAGATTTAGCAGAGATATTACA
G
Sequence Type mRNA
Unitrap ID UNI18488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126477969..126479413 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027361 (Gabpb1) NM_207669 GA repeat binding protein, beta 1 Gene [Source:MGI (curated);Acc:Gabpb1-003]

 
Come back to gene ENSMUSG00000027361


For any suggestions or comments, please send an email to unitrap@crg.es