Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XN390
Clone ID XN390
Vector pGT2Lxf
Project baygenomics

Sequence tag XN390
Sequence
AGAAGCAGCGAACAGAAAAGAGGTAGACTATGAAGCAGGAGACATCCCAACCGAGTGGGAAGCATGGATTAGAAGAACAA
GGAAGACTC
Sequence Type mRNA
Unitrap ID UNI2100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108871561..108881789 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068184 (Ndufaf2) NP_001120818 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 Gene [Source:MGI Symbol;Acc:MGI:1922847]

 
Come back to gene ENSMUSG00000068184


For any suggestions or comments, please send an email to unitrap@crg.es