Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XN536
Clone ID XN536
Vector pGT2Lxf
Project baygenomics

Sequence tag XN536
Sequence
GAAAAGGACCATGGCAGTGGCCAGGATATGGTACCAATCCTT
Sequence Type mRNA
Unitrap ID UNI8752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106731463..106731504 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es