Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST58426
Clone ID OST58426
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST58426
Sequence
CTCCAGGTTCAAGACCGGGAACAGCCCATCCCGTGGAAGGTGCAGTTTAACCTAGGCAACAGCAGCCGACCCAGCAACCA
GTGCCGGAACTCCGTCCAAGGAAAACACCTCCTCACTGATGAGCTGGGCTATGTCTGCGAGAGGAAGGACCTGCTGGCGA
ATGGCTGTTGCGACGTCAGCGTCCCCAGCACAAAGCAGTACTGCTGTGATGGGTGCCTGGCCAATGGCTGCTGTNAAGCC
TACGAGTACTGCGTCTCCTGCTGCCTGCAGCCCAGCAAGCAACTTNTNCTGGAGCGCTTTCTCAACCGGGCATCTGTGGC
CTTTCAAGAACCTTTT
Sequence Type mRNA
Unitrap ID UNI21856

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 118705709..118709439 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032840 (2410131K14Rik) NM_001081236 RIKEN cDNA 2410131K14 gene Gene [Source:MGI Symbol;Acc:MGI:1924042]

 
Come back to gene ENSMUSG00000032840


For any suggestions or comments, please send an email to unitrap@crg.es