Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST58309
Clone ID OST58309
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST58309
Sequence
ATGCCCAGCTGGAGAAGAAGCTTGAGCTGGAGCTGGAGGACGGAGCTCGAGTCATTGCCTGTCGGTTCCCGTTCCCACGC
TGGACTCCAGACCACACCACTGGAGAGGGCATCGACACCGTGTGGGCCTATGACATGAGTGCTCAGAGAGGACGGGGAGG
ACGGCCGAATCAGGAGTGGGTCGGCCAGAAGAACCTCTCGGAGACAGCAGGCCTGCAGGCCTCCTCATCTGAGACACGGA
GCAAGCTCCTTGACGTTGAGTGACAAGTCACCGCTGCTCGTCTTCCGTTCTTGAGAAAATGAACAGAACTCAGAGAAGCA
TTTAAGTTTAAGCTCTGCTGCTTTTTGAAGGGCAGTTTCACACGGCCTGGGGTGGCCTTGCACTTGCTGAGCACGATGAC
CCGGAACTTCTGATCCTTTCACTTTNTACCTGCCAATAAAAAGGNGCTCCTAATNGGGACATCCTGGATAGGGNGCATGA
ANATATAAGTAAGGGACCGTCTGTCTGTGGGTCAAAATTTA
Sequence Type mRNA
Unitrap ID UNI27489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 31546626..31547141 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039065 (Fam173b) NM_026546 family with sequence similarity 173, member B Gene [Source:MGI Symbol;Acc:MGI:1915323]

 
Come back to gene ENSMUSG00000039065


For any suggestions or comments, please send an email to unitrap@crg.es