Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST58147
Clone ID OST58147
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST58147
Sequence
CGACTGACTACTACCAAGTTGGAACCGATCATGCTAGTCTTTGTACACAAAGAATAAAAATGTGAAGAACTTTAC
Sequence Type mRNA
Unitrap ID UNI27322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70258710..70258782 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034892 (Rps29) NM_009093 ribosomal protein S29 Gene [Source:MGI (curated);Acc:Rps29-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 172334931..172335003 70
NO GENE  

 
Come back to gene ENSMUSG00000034892


For any suggestions or comments, please send an email to unitrap@crg.es