Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XN859
Clone ID XN859
Vector pGT2Lxf
Project baygenomics

Sequence tag XN859
Sequence
ATAGGCGTACAGAAACCTTCACAATGAAATCCGAAGCCAAGGATGGAGAGGAGGAAAGTCTGCAAACTGCCTTCAAGAAA
TTAAGAGTGGACGCATCAG
Sequence Type mRNA
Unitrap ID UNI8759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54214571..54214669 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078151 (3230401D17Rik) predicted gene, OTTMUSG00000005670 Gene [Source:MGI Symbol;Acc:MGI:3649742]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163241272..163241370 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035399 (RP23-117O11.3) NM_025699 Uncharacterized protein C20orf111 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9D722]

 
Come back to gene ENSMUSG00000035399


For any suggestions or comments, please send an email to unitrap@crg.es