Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57899
Clone ID OST57899
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57899
Sequence
GACCGCTGGTGTCTCCGAGAGAGAGGCCAATGATGCTCTCAATGCCTATGTGTGCAAAGGACCTCCCCAGCATGAGGAGA
TCTGCCTAGGCCTGTTTACTCTTGTCCTCACTGAGCCTGCCCAAGCCCAGAAGTGTTACCGGGACTTGGCTCTGGTGAGT
CGTGATGGTATGAACATCGTCCTGAACAAGATCAACCAGCTACTTATGGAGAANTACTTGAAGCTTGCAAGATACCTGCC
CGTACTTCA
Sequence Type mRNA
Unitrap ID UNI22501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90219418..90225755 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es