Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XF344
Clone ID XF344
Vector pGT2Lxf
Project baygenomics

Sequence tag XF344
Sequence
CATGTTTCTCAGATTCATCAATCCTGCCATTGTCTCGCCGTATGAAGCAGGGATTTTAGATAAAAAGCCACCACCTAGAA
TTGAAAGGGGCTTGAAGTTAATGTCAAAGGTACTTCAGAGCATTGCCAATCATGTACTGTTCACAAAAGAAGAGCATATG
AGACCTTTTAATGATTTTGTGAAAAGCAACTTTGACTTGGCACGAAGGTTTTTCCTAGATATAGCATCAGATTGTCCCAC
AAGTGATGCAGTAAACCATAGTCTTTCCTTCATCAGCGATGGCAATGTGCTTGCTTTACATCGGCTGCTTTGGAACAATC
AGGAGAAAATTGGCCAGTATCTTTCCAGTAA
Sequence Type mRNA
Unitrap ID UNI8765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79282269..79285080 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es