Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57845
Clone ID OST57845
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57845
Sequence
ACAACTGAGGTGGGGTCTTTCNCAGNAAGGAACTTCAACGACGAAGGGCTTTACCTTGNAAGTCTGTCNCCGGATGATCA
NCCTCCTGGATAAAGATGGTTCTGGCAAGCTGGAGCTTCATGAATTCCAGGTCCTGTGGAAAAAGATCAAGAAATGGACG
GAAATCTTCAAAGAGTGTGATGAGGACCGCTCAGGGAACTTGAACTCCTATGAGATGCGCCTGGCAATAGAGAAAGCAGG
CATCAAGATGAACAACAGAGTGACCGAGGTAGTCGTTGCCAGGTACTCGGATAACATGATTGTGGACTTTGACAGCTTCC
TCAACTGTTTCCTGAGGCTCAAGGCCATGTTTGCGTTCTTCTTATCCATGGACACCAAGAAAACTGGGTCTATTTGGTTN
GGATATTAACCAGGGGCTGCAAATAACCATGTGGGGGGNGGGAGATGCGAACCAA
Sequence Type mRNA
Unitrap ID UNI27509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45767523..45769722 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058626 (Capn11) NP_001013789 calpain 11 Gene [Source:MGI (curated);Acc:Capn11-001]

 
Come back to gene ENSMUSG00000058626


For any suggestions or comments, please send an email to unitrap@crg.es