Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XF345
Clone ID XF345
Vector pGT2Lxf
Project baygenomics

Sequence tag XF345
Sequence
AGCCTGGCTTCTTAGCCTCCGTGAGGAAAGAAGTCACCTACCAGGTCAGGAGACTGAAATCTCACCCCTCCATCATCATA
TGGAGTGGTAATAATGAGAATGAAGTGGCTCTCAGCGTGAACTGGTTCCACGTAAATCCCAGGGACATGAAAACGTACAT
TGACGACTACGTGACCCTCTATGTGAAGAACATCAGGAAGATTGTCTTATCAGAAGACAAGAGCCGTCCTTTCATTGCAT
CCAGCCCAACCAACGGGATGAAAACCATGGAGGAAGGCTGGATCTCTTACGACCCTTATAGCATCCAGTATGGTGATATT
CATTTTTATAACTATGCCGATGACTGCTGGAATTGGAAGATCTTCCC
Sequence Type mRNA
Unitrap ID UNI1683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135210557..135214181 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es