Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57730
Clone ID OST57730
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57730
Sequence
GAGGTGGGGTCTTTCAAGAAGCACAGGATGTCATCCTGCAACTGAGAAAAGAATGCTACTACCTTACTTGTCAGCTGTAT
GCATTGAAAGAGAAGCTAACTTCCCGACAAAGTGAAGAAACGACTCAGNGCTGCAAANGNNATTGNGGAANAAANGTGAA
GATTTGNNGCCANANACATNATTGNNTTTGCCGNCGGTTGATACAATCCTGANGAGCTGAGTNCANTCATTGGGACTNNC
CGNGCTGGAAAGAGAACTGNNCNTCTNCNCCCCACNNAAAGAAGCTGNNCTCTGATCTCTATGCATGCTTCCTCGNGCCT
CCCCCCAAATAAGTAAATAATGTTTTAAAAATGTATAGACAAAGAAGAAGAAGTTTTAAAAAGC
Sequence Type mRNA
Unitrap ID UNI24150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53824815..53826520 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023940 (Sgol1) NM_028232 shugoshin-like 1 (S. pombe) Gene [Source:MGI (curated);Acc:Sgol1-001]

 
Come back to gene ENSMUSG00000023940


For any suggestions or comments, please send an email to unitrap@crg.es