Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57637
Clone ID OST57637
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57637
Sequence
GAGGAAGAATATTCAGCTGTTCGTTNTGCCATAATTTTCTCTGTGAAGATGACCAGTTTGAGCATCAAGCCAGCTGCCAA
GTNNTAGAAGCAGAAACATTTAAATGTAAGTTCTTTTGCTAGCTGTTCTTGTACCTAGGATTCTGAATAGTGAAAATGTG
AAACTTAATTAAAAGGAATAAATTTTTTTTAATGCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 85290476..85290672 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031711 (Zfp330) NM_145600 zinc finger protein 330 Gene [Source:MGI Symbol;Acc:MGI:1353574]

 
Come back to gene ENSMUSG00000031711


For any suggestions or comments, please send an email to unitrap@crg.es