Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57619
Clone ID OST57619
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57619
Sequence
AGCGAGCCCGAGTGCAGGGAGGCTGGGCTACACCTACCAAGAGCCAGTCTGCTACTCAGCCAGCTTCCCCTGCTAGGAGC
CGTCTTTCCCAGACCGCGGGGCCAGCCTGGAGGAGCAAGGAACAGCAGCAATGTGACCGACAATTTGTGTTCAAAGAACC
TCAGCTGGTTGTCCGTGCAGCCCCAGAACCCAGAGTGATTGACAAGGGAGGGTGTGG
Sequence Type mRNA
Unitrap ID UNI27523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 93847004..93848662 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040174 (Alkbh3) NM_026944 alkB, alkylation repair homolog 3 (E. coli) Gene [Source:MGI (curated);Acc:Alkbh3-001]

 
Come back to gene ENSMUSG00000040174


For any suggestions or comments, please send an email to unitrap@crg.es