Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57503
Clone ID OST57503
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57503
Sequence
TTGCTTCTGGAAACCCTGGACCTGGGATTCAAGGTGGAGGAGCTGTTGTACAGAGGGCTATTAAGCGACGGTCAGGGCTG
GATTTTGATGATGAAGTAGAAGTGAACACTAAATTTTTGAGATGCGATGATGACCAGATGTGTAATGACAAAGAGCGGTT
TGCCAGAGTAATCATTCTCAACTCA
Sequence Type mRNA
Unitrap ID UNI16021

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95252330..95264790 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015522 (Arnt) NM_009709 aryl hydrocarbon receptor nuclear translocator Gene [Source:MGI Symbol;Acc:MGI:88071]

 
Come back to gene ENSMUSG00000015522


For any suggestions or comments, please send an email to unitrap@crg.es