Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK416
Clone ID XK416
Vector pGT2Lxf
Project baygenomics

Sequence tag XK416
Sequence
GTTTCGCTTCCTGGTTGAGTGCTTGAATGGTTCTGTGTGCCGTGCTCCGTTTCCTGCGGTTGGATGCTGTGGATTGTGCA
CAGGCAAGCTCCGAAGTTGCGACAT
Sequence Type mRNA
Unitrap ID UNI2332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98218496..98218600 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079490 (AC163298.4)  

 
Come back to gene ENSMUSG00000079490


For any suggestions or comments, please send an email to unitrap@crg.es