Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57478
Clone ID OST57478
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57478
Sequence
CTGAGATTCACTGAAAACACCCTGCAAGTACCACGTGCCTACAACTGCTGCCAGCTTCCCAGGCCACAAGCTGTGGGGAG
CTTGGGGTACAGCAGACTCGTTTCTGTATTCAGCTGCCCAGGCAGAGGAGAATGGGGTCTCCACAGCCTGAAGAATGAAG
ACACGACAGAATAAAGACTCGATGTCAATGAGGAGTGGACGGAAGAAAGAGGCCCCCGGGCCCCGGGAAGAGCTGAGATC
AAGGGGCCGGGCCTCCCCTGGAGGGGTCAGCACATCCAGCAGTGATGGCAAAGCTGAGAAGTCCAGGCAGACAGCCAAGA
AGGCCCGGATAGAGGAGCCCTCTGCCCCAAAGGCCAACAAGCANGGCCCGGAANCGAAGAAAATTACAGCTG
Sequence Type mRNA
Unitrap ID UNI21857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124699319..124699941 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004263 (Atn1) NP_031907 atrophin 1 Gene [Source:MGI (curated);Acc:Atn1-001]

 
Come back to gene ENSMUSG00000004263


For any suggestions or comments, please send an email to unitrap@crg.es