Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57443
Clone ID OST57443
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57443
Sequence
TTGGCGACTTGTCTCCAGATGCAGAGCGTCCTGTATCCTTGGCACAGGCAGGTCCTGAGGTGTAGTTGGAGTAGATTGTG
CCTTCTGAAGCGATACCTGTTTACAATGAAGTTGCAGTCCCCAGAATTCCAGTCCCTTTTCACCGAAGGATTGAAGAGCC
TGACAGAATTATTTGCCAAAGAGAATCATGAATTAAGAATAGCAGGAGGAGCAGTGAGGGATTTACTGAATGGGGTGAAG
CCTCAAGATGTGGATTTCGCCACCACTGCCACCCCTACTCANATGAAGGAGATGTTCCAGTCAGCTGGCATTCGCATGAT
CAACAACAAAGGAGAGAAACATGGGACTATCACTGCCAGGCTTCATGAAGAAAATTTTGAAAGTTACTACACTCCGAATT
GATGTTACCACTGATGGAAGACATGCAGAGGTAGAATTCACAACTGACTGGCAGAAAGACGCTTAACCAAAGAGATCTCA
CTATAAATTCTATGTTTCTANGTTTTGATGGNACACTGTTTGATTACTTCAATGGTTATGCAGATTTAAAAAATAAAA
Sequence Type mRNA
Unitrap ID UNI27531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 106719832..106726169 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013736 (Trnt1) NM_027296 tRNA nucleotidyl transferase, CCA-adding, 1 Gene [Source:MGI (curated);Acc:Trnt1-001]

 
Come back to gene ENSMUSG00000013736


For any suggestions or comments, please send an email to unitrap@crg.es