Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57409
Clone ID OST57409
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57409
Sequence
AACTGAGTTCCTTCGAGTCACCAAGCAGTACCTGCCTCATGTGGCAGCGCCTCTGCCTGATCAGCACCTTCCTGGAGGAT
GGCATCCGCATGTGGTTCCAGTGGAGTGAGCAGCAGTGACTATATCGACACCACCTGGAGCTGTGGCTACCTGTTGGCCT
CATCCTTCGTGTTCCTCAACCTGCTGGGACAATTGACTGGCTGTGTTTTGGTGCTGAGCAGGAACTTCGTGCAGTATGCC
TGCTTTGGGCTGTTTGGAATCATCGCACTGCAGACAATTGCCTATAGCATTTTGTGGGACTTGATCTCTGAACTCTGGAA
CCGG
Sequence Type mRNA
Unitrap ID UNI25270

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26780486..26782477 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014867 (Surf4) NM_011512 surfeit gene 4 Gene [Source:MGI (curated);Acc:Surf4-001]

 
Come back to gene ENSMUSG00000014867


For any suggestions or comments, please send an email to unitrap@crg.es