Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Xk321
Clone ID Xk321
Vector pGT2Lxf
Project baygenomics

Sequence tag Xk321
Sequence
ATTCACTTCGCTGGAGTGGTGGCGCAGCGCTCTCTGCCCGCGGATAAGCATCTACAGTGAAGAAGAAAGAACATCTGGTG
CTAAGGTTTAGTTTAAACCTTTACTGGCTGCTTGGAAAATGAAGATGCAGACTCCAGATTGGCGATTTATATATTCTTCA
TGCAAGGGCAGCATACTAAAAGAGAGAAG
Sequence Type mRNA
Unitrap ID UNI8780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 60059817..60078077 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021981 (Cab39l) NM_026908 calcium binding protein 39-like Gene [Source:MGI Symbol;Acc:MGI:1914081]

 
Come back to gene ENSMUSG00000021981


For any suggestions or comments, please send an email to unitrap@crg.es