Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK001
Clone ID RRK001
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK001
Sequence
GAGGTGGGGGCAGCCGAGTTAGTCCCAAGTCGTCGGACTCCATTTGCTATTCTTTTCTTTCTCTCCCACACCCGTGTGGT
AGTGGGCGTTCGTCTTTGCGTCTCTTTTCATTCATCTCCAGACCTTAAAAGGTTTTTTTAGGGTTGGGGATAGTGGGGAG
GGCAGGCGAGGGGAAAGGAGGAGGACATGGAGATGAAGAAGAAGATTAACATGGAGTTGAAGAACAGAGCCCCGGAGGAG
GTGACAGAGTTAGTCCTCGATAATTGCTTGTGTGTCAATGGGGAAATCGAAGGCCTGAATGACACCTTTAAGGAACTGGA
GTTTCTTAGCATGGCCAACGTGGAGTTGAGTTCCTTGGCCCGGCTTCCCAGCTTGAATAAACTCCGGAAGTTGGAACTTA
GTGACAATATAATTTCTGGAGGCTTGGAAGTCCTGGCAGAGAAATGTCCAAATCTTACCTACCTCAATCTGAGTGGAAAC
AAAATAAAAGATCTCAGTACAGTAGAAGCGCT
Sequence Type mRNA
Unitrap ID UNI8690

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95733334..95738820 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015749 (Anp32e) NM_023210 acidic (leucine-rich) nuclear phosphoprotein 32 family, member E Gene [Source:MGI Symbol;Acc:MGI:1913721]

 
Come back to gene ENSMUSG00000015749


For any suggestions or comments, please send an email to unitrap@crg.es