Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK003
Clone ID RRK003
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK003
Sequence
ACCTTCCCGAACATCGACAGCCCCACCAAGTTCAAACAGCTCTATCGTGCTCGAATGAACACTCTGGAGATGACACCTGA
GGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTG
Sequence Type mRNA
Unitrap ID UNI2972

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77621106..77621238 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005413 (Hmox1) NM_010442 heme oxygenase (decycling) 1 Gene [Source:MGI Symbol;Acc:MGI:96163]

 
Come back to gene ENSMUSG00000005413


For any suggestions or comments, please send an email to unitrap@crg.es