Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA004
Clone ID TEA004
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA004
Sequence
GAGGTGTCGCCCATCAACTACAGCCTCTGCCTCAAGCCCGATTTGCTGGACTTCACCTTCGAGGGCAAGCTGGAGTCCTC
CTGCTCCAGGTAAGGCAGGCAACCAATCAAATTGTGATGAATTGTGCTGATATTGACATTATTACAGCTTCATATGCCCC
AGAAGGAGATGA
Sequence Type mRNA
Unitrap ID UNI464

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97128911..97141601 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001441 (Npepps) NM_008942 aminopeptidase puromycin sensitive Gene [Source:MGI (curated);Acc:Npepps-001]

 
Come back to gene ENSMUSG00000001441


For any suggestions or comments, please send an email to unitrap@crg.es