Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57014
Clone ID OST57014
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57014
Sequence
CTGAGAAGCAGCCTGCTCATGGGCAGCACGCCCCCCAGCTATGGGACCCTGACGACAGGGACGTCAATCGATCCCCTCAG
CTCCTCAGCTTCATCCGTGAGGCTCAGCGGCTACTGTGGCAGTCCATGGAGGGCCATCGGCTATCACGCCGCGGTCTGGA
TGCTGGCCGGGATCCCTTGGCTGCTATTCCGCTGGAAGCCCTTGTGGGGCGTGCGCCTGCGCCTGAAGCCATGCAGCCTG
GCCCACGCCGAAACACTCGTTATAGAAATAAAAGACAAAGAGGGTAGCTCCAGACAGCTCTTCACGGTTCAGGTGCAGAC
TGAGGCTCTTGTCCAGGGCAGCCTGGAGCTGCCCCACAGGCCCAGGCAGAGGATGGCCGGAGCCAGGCAACCGGGGGAGT
GACACCAGAGGGCACATGGCAGGACACCTTCGAACTTCACAGGCAGGAAGAGGCAAAGCAGGTACTGCGCTTTATGTCCT
CAAGGCAACNTACGTCTGGATGGNAACCACAAGCTTNTTGCAAGTAACCTGNTGGACACAGTCGGACCTGGGGATACGTC
ANTTGGTCAGTTCCGGCTNAGCTCAAAACAAGCTNNCAAGAAAACATTTACGGNCCCATGGGAACAGAATTCTGGCAAG
Sequence Type mRNA
Unitrap ID UNI27551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140548049..140550303 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036622 (Atp13a2) NM_029097 ATPase type 13A2 Gene [Source:MGI (curated);Acc:Atp13a2-001]

 
Come back to gene ENSMUSG00000036622


For any suggestions or comments, please send an email to unitrap@crg.es