Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST57005
Clone ID OST57005
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST57005
Sequence
ACTGAGTGGCCAGAACCCCGTTCCCAGTGAGAAGCTTCCAGTGCCTGACAGTGTGCTAAGTATGTTCCCCAGCACAGAGG
AAGGGCCTGAGGACGACAGTGCAAAGCATGGCGGTCGAATCCGAACCTTTCCCCATGAGCGGGGCAACTGGGCCACCCAC
ATCTACATACCGTGTGAGTCACTGACTAAAGTGCCTCTAGCTCTGGCTAGGAGGAAGACACCAGGGCTGCTGTGTGCTGG
ACTCANCTCCCACCGCANACCTGAGGAGACAATGGACCGCCTAACTGCTGAAGTAGACCTTCCTGCACTGGGTGTTNTGT
CAGCTACTGGGTGNNTCATTTCTGCACCTCTAAAGTGGGGGGGATGCTATCTATCTCTTTGGAAAGATTAAATCAGATAA
TCTATGCCNATTAGCCCAATTCGCAA
Sequence Type mRNA
Unitrap ID UNI27552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97857266..97857686 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031792 (AA960436) NM_133954 UPF0406 protein C16orf57 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q91W78]

 
Come back to gene ENSMUSG00000031792


For any suggestions or comments, please send an email to unitrap@crg.es