Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA013
Clone ID TEA013
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA013
Sequence
CTGAGGATTGACTTGGGTTCTGAGAGACTCCTGTCCCGGACCGCAGTGTTAAAAAGACCTGAACACATNTGCTGAAACCT
CTTGCTGTGAGATAGCAGAACTTTTGAGCAGGTTTCTCTACACATAAAAATCTTTTCAAAAATACGGAGAAGAATGGCAG
CAGAAACACAGACACTAAACTTTGGGCCTGAATGGCTCCGTGCTCTGTCCAGTGGTGGGAGTATCACGTCCCCTCCTCTT
TCTCCGGCCCTGCCAAAGTATAAATTAGCAGATTATCGATATGGCCGAGAAGAAATGTTAGCACTTTTCCTTAAAGACTA
CAAGATACCCTTTGATCTTCTGGAGAAAGAATTCCTGCCTATCCTACAGGAGGAGCCCTTGCCACCATTGGCTCTAGTAC
CCTTTACAGAAGAAGAGCAGAGAAACTTTTCCATGTCTGTAAATAGTGCCGCTGTCCTGCGATTGACAGGACGAGGAGGA
GGAGGAGGAACAGTGGTGGGGGCTCCTAGAGGTCGAAGTTCTTCAAGAGGGCGAGGCAGAGGTAGAGGTGAATGTGGTTT
CTACCAAAGAAGTTTTGATGAAGTAGAGGGTGTGTTTGGGCGAGGAGGTGGCAGGGAAATGCATAGATCACAGAGCTGGG
AAGAAAGGGGTGACAGGCGCTTTGAAAAACCAGGAAGAAAAGATGT
Sequence Type mRNA
Unitrap ID UNI8789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89223622..89276581 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048000 (Gigyf2) NM_146112 GRB10 interacting GYF protein 2 Gene [Source:MGI Symbol;Acc:MGI:2138584]

 
Come back to gene ENSMUSG00000048000


For any suggestions or comments, please send an email to unitrap@crg.es