Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST56841
Clone ID OST56841
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST56841
Sequence
ACTGAGCTAGTTCTGACGGTTGTCCCAGACCTGCTGGTGGAGTCTTACCACCATGGACCTGTTGTTTGGGCGCCGGAAGA
CGCCAGAGGAACTACTTCGGCAAAACCAGAGGGCCCTGAACCGAGCCATGAGAGAACTGGACAGGGAACGACAGAAACTA
GAAACCCAGGAAAAGAAAATCATTGCGGACATCAAAAAGATGGCAAAGCAAGGCCAGATGGATGCTGTTCGAATCATGGC
AAAAGACCTGGTGCGTACCCGGAGATATGTACGCAAGTTTGTGTTGATGCGGGCCAACATCCAAGCTGTGTCCCTCAAGA
TACAGACTCTAAAATCCAACAACTCAATGGCACAAGCCATGAAGGGTGTTACTAAGGCCATGGGCACTATGAACAGACAG
CTGAAATTACCCCAGATCCAAAA
Sequence Type mRNA
Unitrap ID UNI27559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13617892..13619393 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033916 (Chmp2a) NM_026885 chromatin modifying protein 2A Gene [Source:MGI Symbol;Acc:MGI:1916203]

 
Come back to gene ENSMUSG00000033916


For any suggestions or comments, please send an email to unitrap@crg.es