Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST56736
Clone ID OST56736
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST56736
Sequence
ACCATCTATTACCTGTTGCTTTTTCCTCCAAAGAATGTTATATTAAGTTTCGNGACCCATCANGTGTTGGTGTGGCCCAG
CATCTAACTAACACGGTTTTTATTGACAGAGCTCTGATAGTAGTTCCTTGTGCAGAAGGTAAAATCCCAGAAGAAGCCAA
AGCCCTCTCTTTACTGGCTCCTGCTCCAACCATGACAAGCCTGGTACCTGGTGCAGGGTTGCTTCCCATCCCAACCTCCA
GTCCTCTGACGGCAGTGAGTAGTCTTGGTGTTTCACTTAGCAGTTTGGGAGCTATCCCAGCAGCAGCGCTGGACCCAAAT
ATTACAACACTTGGAGAGATTCCACAGCCCGCCACTTATGGGGAAAATGGTGGGATCCTTCCAAAATTGATGAAATTAAG
GAAGAACAGTTTATGTTGGAAATTTGAATTCACAGAACAACAACAAGCTGGATCAACTACTTGGAATTTTTTT
Sequence Type mRNA
Unitrap ID UNI27554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 104551110..104559524 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032621 (Sfrs12) NM_172592 splicing factor, arginine/serine-rich 12 Gene [Source:MGI Symbol;Acc:MGI:2145245]

 
Come back to gene ENSMUSG00000032621


For any suggestions or comments, please send an email to unitrap@crg.es