Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST56721
Clone ID OST56721
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST56721
Sequence
ACAGTTGTGCCTATCTTATTACAGGGACTTGCTGNGCTTGCCAAAGGAAAAGGCGCANNNNGAAGATCGAAATTGATTTC
TTGGGAAGAGAANAAACATTTGGTTGCTACTGTANATTTACATGATTACGAGGCAGCTTTAATTGCCATGGATTCCCCTC
CCCACTCTGGACGCCTAAGAACCTTCAGGACCACAGACCTCACTTCTGGAGTTGCAGAAGAGAGCATATCCCTGTCTGAT
TTAATCACCATACTTATC
Sequence Type mRNA
Unitrap ID UNI14400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74698912..74707109 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es