Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA041
Clone ID TEA041
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA041
Sequence
GTTTCCAGTGGCCCCCCCCCTCCCTACTTCGTCTGCTGCGGCCGGGTCGGCTTTTTGCGCTGTAGTGGTCTCTGCGGTTC
CTTGGAAGCACAGCTCCCCTTCCCCGCCCCAGTCCCAGTCCCCGTCCGGCCGCGGACATAAAGATGAGTAGCTCTGAGGA
GGTGTCCTGGATTTCCTGGTTCTGTGGGCTCCGTGGTAATGAATTCTTCTGTGAGGTGGATGAAGACTACATCCAGGACA
AATTTAATCTTACTGGACTCAATGAGCAGGTGCCTCACTATCGACAAGCTCTGGACATGATCTTAGACCTGGAACCT
Sequence Type mRNA
Unitrap ID UNI8797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35256700..35258198 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024387 (Csnk2b) NM_009975 casein kinase 2, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88548]

 
Come back to gene ENSMUSG00000024387


For any suggestions or comments, please send an email to unitrap@crg.es