Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST56561
Clone ID OST56561
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST56561
Sequence
ACTGAGGAAAAGAGGAGAGAAAAGAAGAAAAGATTGTCTTCGCGCCTCTCGGACAGCTCCAGCATCACAGTGCAGGCTGG
GCAGCCGTCGTGACCTGGGGGGCAGCTGCTTGAAAGTGAGGGGTGTAGCCCCGCTCCGAGGGCCTCGGCGATGAACCTGG
ATCCCTGGTTTTCTCCAAGAAGGACTCCAGAGAAAGAGGCCATGAGCCAGCCCCTAGCTGGACAGAGGAGAAGATTCCAG
AAGCCCAAACCACTCCTGCGTTGTGTAAGGACCGGAGGACAATGGCCTGGGCACAGGGCTCACCCTGGAGAGCCACAAGG
ACCCATCTAGCCATCCAGGCCTANCTGGCCAGGGACAAAGGAAAAATTTTAAAAAACCCAAAAATTTTAA
Sequence Type mRNA
Unitrap ID UNI13870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151968775..151974740 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068079 (Tcf15) NM_009328 transcription factor 15 Gene [Source:MGI (curated);Acc:Tcf15-001]

 
Come back to gene ENSMUSG00000068079


For any suggestions or comments, please send an email to unitrap@crg.es