Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA059
Clone ID TEA059
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA059
Sequence
GCGGGACTGTTCTCCACCGACCATCGCGGGGCCGGGAGTGAATAGCTCATCTTGGCTCTGGAGACTTGAAGGTTAGATGG
AGCTTGACCGATGTTGGGTATCCCTCAGCTATCAAGGATCCTGCATTGAACAGAGAAGATGACTACAGAATTGAAAGAGA
CCATGGGCAGAGCCTCTTGGGACCCAGAGAAGGTGAAAATGGAAGAAGATGATGAAAGTGTCATAAGTCAGGCATCCAGC
CAACAAGTGTACTATGAGAACGACAAGGACTGTGCCCCAGGGGAGGGTCCTTATGGAAGCATCAGTGTATCAGAAGATGA
GGAAAAGGGTCAGGAAATGTTCCGGGAAATGGCAGTGGTGCTAAAAGCAACACAGGAGGCTGCTGCTGCTTCACCCTTTG
GGAGCTACTCGTTGGCAGGGACTCTGGCCGAGAGTCAAATCCTGGAGCTTCATGGGAACCCAACCCCAA
Sequence Type mRNA
Unitrap ID UNI8804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122832299..122835569 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057895 (Zfp105) NM_009544 zinc finger protein 105 Gene [Source:MGI (curated);Acc:Zfp105-001]

 
Come back to gene ENSMUSG00000057895


For any suggestions or comments, please send an email to unitrap@crg.es