Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA063
Clone ID TEA063
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA063
Sequence
CAGGCCAACAAGAAGAGTGAGGGTAGTCTGGCATATGTGAAGGGCGGCCTCAGTACCTTCTTTGAAGCTCAAGATGCTCT
CTCAGCTATCCATCAAAAACTAGAAGCAGATGGAACTGAAAAAGTAGAAGGATCCATGACACAGAAATTGGAGAATGTCC
TCAATAGAGCAAGTAACACCGCTGACACATTGTTCCAAGAAGTATTAGGTCGGAAAGACAAGGCAGATTCCACTAGGAAC
GCCCTCAACGTACTTCAGCGATTTAAATTTCTCTTCAACCTTCCTCTCAATATTAAACGGAATATTCAAAAGGGGGATTA
TGATGTAGTTATTAATGATTATGAAAAAGCCAAATCGCTCTTTGGGAAAACGGAGGTGCAAGTTTTCAAGAAATATTATG
CTGAAGTAGAAGCAGGAATTGAAGATCTAAGAGAGTTACTTCTAAAGAAATTGCTCGAGACTCCATCAACCTTACATGAC
CAGAAGCGCTACATAAGGTATCTTTCCGACCTCCATGCACCTGGTGACCCTGCTTGGCAGTGTATTGGAGCTCAGCACAA
GTGGACCCTCAAGCTCATGCAAGACTGCAAAGAAGGCCACATGAAGAGCCTAAA
Sequence Type mRNA
Unitrap ID UNI8807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 30992656..31017676 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021357 (Exoc2) NM_025588 exocyst complex component 2 Gene [Source:MGI (curated);Acc:Exoc2-001]

 
Come back to gene ENSMUSG00000021357


For any suggestions or comments, please send an email to unitrap@crg.es