Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BB0859
Clone ID BB0859
Vector pGT2lxr
Project sanger

Sequence tag BB0859
Sequence
GGATTCTCCGGAGGGCGAAATTAGACCCTGCCCCCGGGTATAGAAGTCGACTTTTTTTTTTTTTTTCCGAAGCCAAGGTT
CCACGCGGAGACTGGGGGCTTAGAACCCGGGCTGGGAGGGCGAGACTGTGCGGGAGGGAGCCGCTTCTTAGCCTGTCCTA
CGGAAGCCTGCGAGGGAGGGTGGTATCCACTCCCCAAATCCAGTGTCCTGATGCCCAGCGCCAACGCCAGCCGTAAGGGT
CAAGAGAAGCCGCGGGAGGTCGTGGACGCAGAGGAAGTCCCACTACGG
Sequence Type mRNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130313727..130313941 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]

 
Come back to gene ENSMUSG00000026356


For any suggestions or comments, please send an email to unitrap@crg.es